ID: 937845398

View in Genome Browser
Species Human (GRCh38)
Location 2:126573575-126573597
Sequence CTTTGCCCCAGTGCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937845386_937845398 28 Left 937845386 2:126573524-126573546 CCACACCTTTTCCATGCCTCAGT No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845396_937845398 -10 Left 937845396 2:126573562-126573584 CCTCTTTCTATGCCTTTGCCCCA No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845391_937845398 12 Left 937845391 2:126573540-126573562 CCTCAGTGGCCTGCCTGGCCACC No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845395_937845398 -9 Left 937845395 2:126573561-126573583 CCCTCTTTCTATGCCTTTGCCCC No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845392_937845398 3 Left 937845392 2:126573549-126573571 CCTGCCTGGCCACCCTCTTTCTA No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845393_937845398 -1 Left 937845393 2:126573553-126573575 CCTGGCCACCCTCTTTCTATGCC No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845389_937845398 17 Left 937845389 2:126573535-126573557 CCATGCCTCAGTGGCCTGCCTGG No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845388_937845398 23 Left 937845388 2:126573529-126573551 CCTTTTCCATGCCTCAGTGGCCT No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data
937845394_937845398 -6 Left 937845394 2:126573558-126573580 CCACCCTCTTTCTATGCCTTTGC No data
Right 937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937845398 Original CRISPR CTTTGCCCCAGTGCAGTGTC TGG Intergenic
No off target data available for this crispr