ID: 937845497

View in Genome Browser
Species Human (GRCh38)
Location 2:126574405-126574427
Sequence GAGGATCCCACAAGAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937845497_937845502 17 Left 937845497 2:126574405-126574427 CCTTCCACTCTTGTGGGATCCTC No data
Right 937845502 2:126574445-126574467 GTAACATCTTCAGACATGAGTGG No data
937845497_937845504 26 Left 937845497 2:126574405-126574427 CCTTCCACTCTTGTGGGATCCTC No data
Right 937845504 2:126574454-126574476 TCAGACATGAGTGGGCCGCTTGG No data
937845497_937845503 18 Left 937845497 2:126574405-126574427 CCTTCCACTCTTGTGGGATCCTC No data
Right 937845503 2:126574446-126574468 TAACATCTTCAGACATGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937845497 Original CRISPR GAGGATCCCACAAGAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr