ID: 937845629

View in Genome Browser
Species Human (GRCh38)
Location 2:126575889-126575911
Sequence AGAGCCTGTTTGCAGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937845626_937845629 6 Left 937845626 2:126575860-126575882 CCATCCAAGTCCTCTCACAGCAC No data
Right 937845629 2:126575889-126575911 AGAGCCTGTTTGCAGCTGCCAGG No data
937845628_937845629 -4 Left 937845628 2:126575870-126575892 CCTCTCACAGCACTGAAGCAGAG No data
Right 937845629 2:126575889-126575911 AGAGCCTGTTTGCAGCTGCCAGG No data
937845625_937845629 18 Left 937845625 2:126575848-126575870 CCAAGAGGCACTCCATCCAAGTC No data
Right 937845629 2:126575889-126575911 AGAGCCTGTTTGCAGCTGCCAGG No data
937845627_937845629 2 Left 937845627 2:126575864-126575886 CCAAGTCCTCTCACAGCACTGAA No data
Right 937845629 2:126575889-126575911 AGAGCCTGTTTGCAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937845629 Original CRISPR AGAGCCTGTTTGCAGCTGCC AGG Intergenic
No off target data available for this crispr