ID: 937847871

View in Genome Browser
Species Human (GRCh38)
Location 2:126601452-126601474
Sequence GAGTCACCTGTGGGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937847862_937847871 28 Left 937847862 2:126601401-126601423 CCCTATCCTCTAGTCAGCAGTCC No data
Right 937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG No data
937847865_937847871 7 Left 937847865 2:126601422-126601444 CCTGAGATATACAGTGACATGAA No data
Right 937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG No data
937847864_937847871 22 Left 937847864 2:126601407-126601429 CCTCTAGTCAGCAGTCCTGAGAT No data
Right 937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG No data
937847863_937847871 27 Left 937847863 2:126601402-126601424 CCTATCCTCTAGTCAGCAGTCCT No data
Right 937847871 2:126601452-126601474 GAGTCACCTGTGGGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937847871 Original CRISPR GAGTCACCTGTGGGGAGGCC TGG Intergenic
No off target data available for this crispr