ID: 937851932

View in Genome Browser
Species Human (GRCh38)
Location 2:126643620-126643642
Sequence CAGGAGTCCATGGGGACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937851921_937851932 1 Left 937851921 2:126643596-126643618 CCCCATGCAGCTGTGCCGTGGCA No data
Right 937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG No data
937851920_937851932 2 Left 937851920 2:126643595-126643617 CCCCCATGCAGCTGTGCCGTGGC No data
Right 937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG No data
937851923_937851932 -1 Left 937851923 2:126643598-126643620 CCATGCAGCTGTGCCGTGGCACC No data
Right 937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG No data
937851922_937851932 0 Left 937851922 2:126643597-126643619 CCCATGCAGCTGTGCCGTGGCAC No data
Right 937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG No data
937851918_937851932 15 Left 937851918 2:126643582-126643604 CCAGCATGAATCACCCCCATGCA No data
Right 937851932 2:126643620-126643642 CAGGAGTCCATGGGGACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937851932 Original CRISPR CAGGAGTCCATGGGGACATG GGG Intergenic
No off target data available for this crispr