ID: 937852569

View in Genome Browser
Species Human (GRCh38)
Location 2:126648729-126648751
Sequence GACAGCACTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937852569_937852573 15 Left 937852569 2:126648729-126648751 CCAGTAACAGGCCAAGTGCTGTC No data
Right 937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG No data
937852569_937852572 5 Left 937852569 2:126648729-126648751 CCAGTAACAGGCCAAGTGCTGTC No data
Right 937852572 2:126648757-126648779 AAAGGAGAGTAGCTATCTGCAGG No data
937852569_937852574 16 Left 937852569 2:126648729-126648751 CCAGTAACAGGCCAAGTGCTGTC No data
Right 937852574 2:126648768-126648790 GCTATCTGCAGGAGATGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937852569 Original CRISPR GACAGCACTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr