ID: 937852573

View in Genome Browser
Species Human (GRCh38)
Location 2:126648767-126648789
Sequence AGCTATCTGCAGGAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937852568_937852573 16 Left 937852568 2:126648728-126648750 CCCAGTAACAGGCCAAGTGCTGT No data
Right 937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG No data
937852566_937852573 25 Left 937852566 2:126648719-126648741 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG No data
937852569_937852573 15 Left 937852569 2:126648729-126648751 CCAGTAACAGGCCAAGTGCTGTC No data
Right 937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG No data
937852567_937852573 22 Left 937852567 2:126648722-126648744 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG No data
937852571_937852573 4 Left 937852571 2:126648740-126648762 CCAAGTGCTGTCTCTCAAAAGGA No data
Right 937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937852573 Original CRISPR AGCTATCTGCAGGAGATGAC AGG Intergenic
No off target data available for this crispr