ID: 937856517

View in Genome Browser
Species Human (GRCh38)
Location 2:126675549-126675571
Sequence GAAGCTACTGAGAAAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937856517_937856519 0 Left 937856517 2:126675549-126675571 CCTGATTCTTTCTCAGTAGCTTC No data
Right 937856519 2:126675572-126675594 AAAGTGCTATTCTAAACAATGGG No data
937856517_937856518 -1 Left 937856517 2:126675549-126675571 CCTGATTCTTTCTCAGTAGCTTC No data
Right 937856518 2:126675571-126675593 CAAAGTGCTATTCTAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937856517 Original CRISPR GAAGCTACTGAGAAAGAATC AGG (reversed) Intronic
No off target data available for this crispr