ID: 937858887

View in Genome Browser
Species Human (GRCh38)
Location 2:126692869-126692891
Sequence GCCAAGTCCTGACCTGATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937858883_937858887 14 Left 937858883 2:126692832-126692854 CCAAGAGAGAAAGTGCACTCCAG No data
Right 937858887 2:126692869-126692891 GCCAAGTCCTGACCTGATATCGG No data
937858886_937858887 -5 Left 937858886 2:126692851-126692873 CCAGAGGCAAGAGCACTGGCCAA No data
Right 937858887 2:126692869-126692891 GCCAAGTCCTGACCTGATATCGG No data
937858882_937858887 30 Left 937858882 2:126692816-126692838 CCTGGGAAGGGCTTCTCCAAGAG No data
Right 937858887 2:126692869-126692891 GCCAAGTCCTGACCTGATATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937858887 Original CRISPR GCCAAGTCCTGACCTGATAT CGG Intronic
No off target data available for this crispr