ID: 937862342

View in Genome Browser
Species Human (GRCh38)
Location 2:126720861-126720883
Sequence CACAGCCTGGGGAAGTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937862336_937862342 -7 Left 937862336 2:126720845-126720867 CCTCCAGGCTTAGTCACACAGCC No data
Right 937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG No data
937862331_937862342 20 Left 937862331 2:126720818-126720840 CCACAGTGACTTGAGCTGAGGGG No data
Right 937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG No data
937862335_937862342 -6 Left 937862335 2:126720844-126720866 CCCTCCAGGCTTAGTCACACAGC No data
Right 937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG No data
937862334_937862342 -5 Left 937862334 2:126720843-126720865 CCCCTCCAGGCTTAGTCACACAG No data
Right 937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG No data
937862337_937862342 -10 Left 937862337 2:126720848-126720870 CCAGGCTTAGTCACACAGCCTGG No data
Right 937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937862342 Original CRISPR CACAGCCTGGGGAAGTCTGG AGG Intergenic
No off target data available for this crispr