ID: 937862574

View in Genome Browser
Species Human (GRCh38)
Location 2:126722551-126722573
Sequence CCCTGGGGATTCCCCGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937862568_937862574 2 Left 937862568 2:126722526-126722548 CCAGACATTCAGTGGTCCAATGA No data
Right 937862574 2:126722551-126722573 CCCTGGGGATTCCCCGAGTCTGG No data
937862566_937862574 12 Left 937862566 2:126722516-126722538 CCTCAGTGGACCAGACATTCAGT No data
Right 937862574 2:126722551-126722573 CCCTGGGGATTCCCCGAGTCTGG No data
937862565_937862574 21 Left 937862565 2:126722507-126722529 CCTTCTCTTCCTCAGTGGACCAG No data
Right 937862574 2:126722551-126722573 CCCTGGGGATTCCCCGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937862574 Original CRISPR CCCTGGGGATTCCCCGAGTC TGG Intergenic
No off target data available for this crispr