ID: 937862646

View in Genome Browser
Species Human (GRCh38)
Location 2:126723000-126723022
Sequence CAGCAGACAGCAGTGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937862642_937862646 2 Left 937862642 2:126722975-126722997 CCTGCAACCACTGAGAGTGGCAT No data
Right 937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG No data
937862643_937862646 -5 Left 937862643 2:126722982-126723004 CCACTGAGAGTGGCATCACAGCA No data
Right 937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG No data
937862640_937862646 12 Left 937862640 2:126722965-126722987 CCGCAGTCTTCCTGCAACCACTG No data
Right 937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937862646 Original CRISPR CAGCAGACAGCAGTGGCAGA GGG Intergenic
No off target data available for this crispr