ID: 937862878

View in Genome Browser
Species Human (GRCh38)
Location 2:126724852-126724874
Sequence GTGTTTAACCAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937862878_937862889 27 Left 937862878 2:126724852-126724874 CCCTCTTCCTTCTGGTTAAACAC No data
Right 937862889 2:126724902-126724924 CCTGCTTCTCCTTGGGGGAGAGG No data
937862878_937862885 20 Left 937862878 2:126724852-126724874 CCCTCTTCCTTCTGGTTAAACAC No data
Right 937862885 2:126724895-126724917 ACAGCTGCCTGCTTCTCCTTGGG No data
937862878_937862887 22 Left 937862878 2:126724852-126724874 CCCTCTTCCTTCTGGTTAAACAC No data
Right 937862887 2:126724897-126724919 AGCTGCCTGCTTCTCCTTGGGGG No data
937862878_937862886 21 Left 937862878 2:126724852-126724874 CCCTCTTCCTTCTGGTTAAACAC No data
Right 937862886 2:126724896-126724918 CAGCTGCCTGCTTCTCCTTGGGG No data
937862878_937862884 19 Left 937862878 2:126724852-126724874 CCCTCTTCCTTCTGGTTAAACAC No data
Right 937862884 2:126724894-126724916 CACAGCTGCCTGCTTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937862878 Original CRISPR GTGTTTAACCAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr