ID: 937866184

View in Genome Browser
Species Human (GRCh38)
Location 2:126753230-126753252
Sequence GCCCATGCACTGAGCATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937866184_937866191 13 Left 937866184 2:126753230-126753252 CCACCCATGCTCAGTGCATGGGC No data
Right 937866191 2:126753266-126753288 CTACCCTATTCCCTGCTGGGAGG No data
937866184_937866190 10 Left 937866184 2:126753230-126753252 CCACCCATGCTCAGTGCATGGGC No data
Right 937866190 2:126753263-126753285 ACACTACCCTATTCCCTGCTGGG No data
937866184_937866196 28 Left 937866184 2:126753230-126753252 CCACCCATGCTCAGTGCATGGGC No data
Right 937866196 2:126753281-126753303 CTGGGAGGAAAATAACTCAACGG No data
937866184_937866197 29 Left 937866184 2:126753230-126753252 CCACCCATGCTCAGTGCATGGGC No data
Right 937866197 2:126753282-126753304 TGGGAGGAAAATAACTCAACGGG No data
937866184_937866198 30 Left 937866184 2:126753230-126753252 CCACCCATGCTCAGTGCATGGGC No data
Right 937866198 2:126753283-126753305 GGGAGGAAAATAACTCAACGGGG No data
937866184_937866189 9 Left 937866184 2:126753230-126753252 CCACCCATGCTCAGTGCATGGGC No data
Right 937866189 2:126753262-126753284 GACACTACCCTATTCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937866184 Original CRISPR GCCCATGCACTGAGCATGGG TGG (reversed) Intergenic
No off target data available for this crispr