ID: 937870425

View in Genome Browser
Species Human (GRCh38)
Location 2:126782272-126782294
Sequence CCTTGCGCTCCCGTCCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937870425_937870435 14 Left 937870425 2:126782272-126782294 CCCAAGGGGACGGGAGCGCAAGG No data
Right 937870435 2:126782309-126782331 CCGCACAGAGGCCTCTCAAAGGG No data
937870425_937870433 13 Left 937870425 2:126782272-126782294 CCCAAGGGGACGGGAGCGCAAGG No data
Right 937870433 2:126782308-126782330 CCCGCACAGAGGCCTCTCAAAGG No data
937870425_937870429 2 Left 937870425 2:126782272-126782294 CCCAAGGGGACGGGAGCGCAAGG No data
Right 937870429 2:126782297-126782319 GGCACCCGACTCCCGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937870425 Original CRISPR CCTTGCGCTCCCGTCCCCTT GGG (reversed) Intergenic
No off target data available for this crispr