ID: 937871300

View in Genome Browser
Species Human (GRCh38)
Location 2:126788161-126788183
Sequence AACAGCCTGGTGAGGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937871293_937871300 -3 Left 937871293 2:126788141-126788163 CCTTCATGCTCTCCTATGCCAAC No data
Right 937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG No data
937871291_937871300 10 Left 937871291 2:126788128-126788150 CCATGAAATTAGCCCTTCATGCT No data
Right 937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG No data
937871292_937871300 -2 Left 937871292 2:126788140-126788162 CCCTTCATGCTCTCCTATGCCAA No data
Right 937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937871300 Original CRISPR AACAGCCTGGTGAGGGCTGG TGG Intergenic
No off target data available for this crispr