ID: 937871763

View in Genome Browser
Species Human (GRCh38)
Location 2:126791310-126791332
Sequence TGTGTGGGCTGCAGCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937871753_937871763 6 Left 937871753 2:126791281-126791303 CCAAGGTCTACCCTCAGCCCCTC No data
Right 937871763 2:126791310-126791332 TGTGTGGGCTGCAGCTGAGGAGG No data
937871752_937871763 18 Left 937871752 2:126791269-126791291 CCTTCAGAAAGTCCAAGGTCTAC No data
Right 937871763 2:126791310-126791332 TGTGTGGGCTGCAGCTGAGGAGG No data
937871755_937871763 -5 Left 937871755 2:126791292-126791314 CCTCAGCCCCTCAGCTCCTGTGT No data
Right 937871763 2:126791310-126791332 TGTGTGGGCTGCAGCTGAGGAGG No data
937871754_937871763 -4 Left 937871754 2:126791291-126791313 CCCTCAGCCCCTCAGCTCCTGTG No data
Right 937871763 2:126791310-126791332 TGTGTGGGCTGCAGCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937871763 Original CRISPR TGTGTGGGCTGCAGCTGAGG AGG Intergenic
No off target data available for this crispr