ID: 937876266

View in Genome Browser
Species Human (GRCh38)
Location 2:126827680-126827702
Sequence CTGGCTTCCCGCAGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937876256_937876266 20 Left 937876256 2:126827637-126827659 CCTGCTTAATTATCAATGGGCTG No data
Right 937876266 2:126827680-126827702 CTGGCTTCCCGCAGCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937876266 Original CRISPR CTGGCTTCCCGCAGCCCTGG AGG Intergenic
No off target data available for this crispr