ID: 937878050

View in Genome Browser
Species Human (GRCh38)
Location 2:126840492-126840514
Sequence GAATCCTGGATTGGAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937878050_937878055 22 Left 937878050 2:126840492-126840514 CCAGGACCTCCAATCCAGGATTC No data
Right 937878055 2:126840537-126840559 CTACATCTCTACCATAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937878050 Original CRISPR GAATCCTGGATTGGAGGTCC TGG (reversed) Intergenic
No off target data available for this crispr