ID: 937878812

View in Genome Browser
Species Human (GRCh38)
Location 2:126849893-126849915
Sequence CTGTATGAAAGGCACCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937878812_937878822 18 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875
937878812_937878816 -2 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878816 2:126849914-126849936 AGTAGAAGAGAGAAAGACAAAGG No data
937878812_937878819 7 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878812_937878817 1 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878817 2:126849917-126849939 AGAAGAGAGAAAGACAAAGGAGG No data
937878812_937878818 4 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878818 2:126849920-126849942 AGAGAGAAAGACAAAGGAGGAGG No data
937878812_937878821 17 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG No data
937878812_937878820 13 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937878812 Original CRISPR CTGTATGAAAGGCACCAGGG AGG (reversed) Intergenic
No off target data available for this crispr