ID: 937878819

View in Genome Browser
Species Human (GRCh38)
Location 2:126849923-126849945
Sequence GAGAAAGACAAAGGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937878815_937878819 -4 Left 937878815 2:126849904-126849926 CCTTTCATACAGTAGAAGAGAGA No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878810_937878819 18 Left 937878810 2:126849882-126849904 CCACCTGAGTGCCTCCCTGGTGC No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878805_937878819 30 Left 937878805 2:126849870-126849892 CCCCCAGGAAAACCACCTGAGTG No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878806_937878819 29 Left 937878806 2:126849871-126849893 CCCCAGGAAAACCACCTGAGTGC No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878812_937878819 7 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878807_937878819 28 Left 937878807 2:126849872-126849894 CCCAGGAAAACCACCTGAGTGCC No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878808_937878819 27 Left 937878808 2:126849873-126849895 CCAGGAAAACCACCTGAGTGCCT No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878814_937878819 3 Left 937878814 2:126849897-126849919 CCTGGTGCCTTTCATACAGTAGA No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878811_937878819 15 Left 937878811 2:126849885-126849907 CCTGAGTGCCTCCCTGGTGCCTT No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data
937878813_937878819 4 Left 937878813 2:126849896-126849918 CCCTGGTGCCTTTCATACAGTAG No data
Right 937878819 2:126849923-126849945 GAGAAAGACAAAGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937878819 Original CRISPR GAGAAAGACAAAGGAGGAGG AGG Intergenic
No off target data available for this crispr