ID: 937878820

View in Genome Browser
Species Human (GRCh38)
Location 2:126849929-126849951
Sequence GACAAAGGAGGAGGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937878814_937878820 9 Left 937878814 2:126849897-126849919 CCTGGTGCCTTTCATACAGTAGA No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data
937878815_937878820 2 Left 937878815 2:126849904-126849926 CCTTTCATACAGTAGAAGAGAGA No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data
937878811_937878820 21 Left 937878811 2:126849885-126849907 CCTGAGTGCCTCCCTGGTGCCTT No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data
937878813_937878820 10 Left 937878813 2:126849896-126849918 CCCTGGTGCCTTTCATACAGTAG No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data
937878812_937878820 13 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data
937878810_937878820 24 Left 937878810 2:126849882-126849904 CCACCTGAGTGCCTCCCTGGTGC No data
Right 937878820 2:126849929-126849951 GACAAAGGAGGAGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937878820 Original CRISPR GACAAAGGAGGAGGAGGAGC AGG Intergenic
No off target data available for this crispr