ID: 937878822

View in Genome Browser
Species Human (GRCh38)
Location 2:126849934-126849956
Sequence AGGAGGAGGAGGAGCAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8318
Summary {0: 2, 1: 67, 2: 529, 3: 1845, 4: 5875}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937878810_937878822 29 Left 937878810 2:126849882-126849904 CCACCTGAGTGCCTCCCTGGTGC No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875
937878813_937878822 15 Left 937878813 2:126849896-126849918 CCCTGGTGCCTTTCATACAGTAG No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875
937878814_937878822 14 Left 937878814 2:126849897-126849919 CCTGGTGCCTTTCATACAGTAGA No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875
937878811_937878822 26 Left 937878811 2:126849885-126849907 CCTGAGTGCCTCCCTGGTGCCTT No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875
937878812_937878822 18 Left 937878812 2:126849893-126849915 CCTCCCTGGTGCCTTTCATACAG No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875
937878815_937878822 7 Left 937878815 2:126849904-126849926 CCTTTCATACAGTAGAAGAGAGA No data
Right 937878822 2:126849934-126849956 AGGAGGAGGAGGAGCAGGAAGGG 0: 2
1: 67
2: 529
3: 1845
4: 5875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937878822 Original CRISPR AGGAGGAGGAGGAGCAGGAA GGG Intergenic
Too many off-targets to display for this crispr