ID: 937880733

View in Genome Browser
Species Human (GRCh38)
Location 2:126862688-126862710
Sequence TCATCTCAGTGTCCAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937880733_937880735 -5 Left 937880733 2:126862688-126862710 CCTTCTTTTGGACACTGAGATGA No data
Right 937880735 2:126862706-126862728 GATGACCTGTCCACATGTAAGGG No data
937880733_937880734 -6 Left 937880733 2:126862688-126862710 CCTTCTTTTGGACACTGAGATGA No data
Right 937880734 2:126862705-126862727 AGATGACCTGTCCACATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937880733 Original CRISPR TCATCTCAGTGTCCAAAAGA AGG (reversed) Intergenic
No off target data available for this crispr