ID: 937881914

View in Genome Browser
Species Human (GRCh38)
Location 2:126874587-126874609
Sequence TTTGTTTAAACAATGTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937881914_937881919 19 Left 937881914 2:126874587-126874609 CCCAAAAACATTGTTTAAACAAA No data
Right 937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG No data
937881914_937881918 7 Left 937881914 2:126874587-126874609 CCCAAAAACATTGTTTAAACAAA No data
Right 937881918 2:126874617-126874639 AGACACATTCTATAAATAGGAGG No data
937881914_937881916 4 Left 937881914 2:126874587-126874609 CCCAAAAACATTGTTTAAACAAA No data
Right 937881916 2:126874614-126874636 ACCAGACACATTCTATAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937881914 Original CRISPR TTTGTTTAAACAATGTTTTT GGG (reversed) Intergenic
No off target data available for this crispr