ID: 937881915

View in Genome Browser
Species Human (GRCh38)
Location 2:126874588-126874610
Sequence TTTTGTTTAAACAATGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937881915_937881919 18 Left 937881915 2:126874588-126874610 CCAAAAACATTGTTTAAACAAAA No data
Right 937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG No data
937881915_937881918 6 Left 937881915 2:126874588-126874610 CCAAAAACATTGTTTAAACAAAA No data
Right 937881918 2:126874617-126874639 AGACACATTCTATAAATAGGAGG No data
937881915_937881916 3 Left 937881915 2:126874588-126874610 CCAAAAACATTGTTTAAACAAAA No data
Right 937881916 2:126874614-126874636 ACCAGACACATTCTATAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937881915 Original CRISPR TTTTGTTTAAACAATGTTTT TGG (reversed) Intergenic
No off target data available for this crispr