ID: 937881916

View in Genome Browser
Species Human (GRCh38)
Location 2:126874614-126874636
Sequence ACCAGACACATTCTATAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937881914_937881916 4 Left 937881914 2:126874587-126874609 CCCAAAAACATTGTTTAAACAAA No data
Right 937881916 2:126874614-126874636 ACCAGACACATTCTATAAATAGG No data
937881915_937881916 3 Left 937881915 2:126874588-126874610 CCAAAAACATTGTTTAAACAAAA No data
Right 937881916 2:126874614-126874636 ACCAGACACATTCTATAAATAGG No data
937881913_937881916 29 Left 937881913 2:126874562-126874584 CCACTGATACTTGGGTGGATCAA No data
Right 937881916 2:126874614-126874636 ACCAGACACATTCTATAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937881916 Original CRISPR ACCAGACACATTCTATAAAT AGG Intergenic
No off target data available for this crispr