ID: 937881917

View in Genome Browser
Species Human (GRCh38)
Location 2:126874615-126874637
Sequence TCCTATTTATAGAATGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937881917_937881920 13 Left 937881917 2:126874615-126874637 CCAGACACATTCTATAAATAGGA No data
Right 937881920 2:126874651-126874673 GAAAAACTAATCTATTGTGATGG No data
937881917_937881919 -9 Left 937881917 2:126874615-126874637 CCAGACACATTCTATAAATAGGA No data
Right 937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937881917 Original CRISPR TCCTATTTATAGAATGTGTC TGG (reversed) Intergenic
No off target data available for this crispr