ID: 937881918

View in Genome Browser
Species Human (GRCh38)
Location 2:126874617-126874639
Sequence AGACACATTCTATAAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937881915_937881918 6 Left 937881915 2:126874588-126874610 CCAAAAACATTGTTTAAACAAAA No data
Right 937881918 2:126874617-126874639 AGACACATTCTATAAATAGGAGG No data
937881914_937881918 7 Left 937881914 2:126874587-126874609 CCCAAAAACATTGTTTAAACAAA No data
Right 937881918 2:126874617-126874639 AGACACATTCTATAAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937881918 Original CRISPR AGACACATTCTATAAATAGG AGG Intergenic
No off target data available for this crispr