ID: 937881919

View in Genome Browser
Species Human (GRCh38)
Location 2:126874629-126874651
Sequence TAAATAGGAGGTTCGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937881914_937881919 19 Left 937881914 2:126874587-126874609 CCCAAAAACATTGTTTAAACAAA No data
Right 937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG No data
937881917_937881919 -9 Left 937881917 2:126874615-126874637 CCAGACACATTCTATAAATAGGA No data
Right 937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG No data
937881915_937881919 18 Left 937881915 2:126874588-126874610 CCAAAAACATTGTTTAAACAAAA No data
Right 937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937881919 Original CRISPR TAAATAGGAGGTTCGAGAGC AGG Intergenic
No off target data available for this crispr