ID: 937888216

View in Genome Browser
Species Human (GRCh38)
Location 2:126915086-126915108
Sequence AGCCAGGCCTGTGCTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937888210_937888216 22 Left 937888210 2:126915041-126915063 CCTAGAGAAGCCATCAACACGTC No data
Right 937888216 2:126915086-126915108 AGCCAGGCCTGTGCTACACAGGG No data
937888209_937888216 28 Left 937888209 2:126915035-126915057 CCGATTCCTAGAGAAGCCATCAA No data
Right 937888216 2:126915086-126915108 AGCCAGGCCTGTGCTACACAGGG No data
937888213_937888216 -5 Left 937888213 2:126915068-126915090 CCAATGCAGGATGCGCTGAGCCA No data
Right 937888216 2:126915086-126915108 AGCCAGGCCTGTGCTACACAGGG No data
937888211_937888216 12 Left 937888211 2:126915051-126915073 CCATCAACACGTCTGAGCCAATG No data
Right 937888216 2:126915086-126915108 AGCCAGGCCTGTGCTACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937888216 Original CRISPR AGCCAGGCCTGTGCTACACA GGG Intergenic
No off target data available for this crispr