ID: 937888790

View in Genome Browser
Species Human (GRCh38)
Location 2:126919231-126919253
Sequence CGGTATCCAGAGATTGTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937888783_937888790 23 Left 937888783 2:126919185-126919207 CCCAGCACATCAATGCATTCACC No data
Right 937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG No data
937888785_937888790 2 Left 937888785 2:126919206-126919228 CCAATCATGAAGTTCCACTGAGC No data
Right 937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG No data
937888784_937888790 22 Left 937888784 2:126919186-126919208 CCAGCACATCAATGCATTCACCA No data
Right 937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG No data
937888782_937888790 24 Left 937888782 2:126919184-126919206 CCCCAGCACATCAATGCATTCAC No data
Right 937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG No data
937888781_937888790 25 Left 937888781 2:126919183-126919205 CCCCCAGCACATCAATGCATTCA No data
Right 937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937888790 Original CRISPR CGGTATCCAGAGATTGTATT GGG Intergenic
No off target data available for this crispr