ID: 937892595

View in Genome Browser
Species Human (GRCh38)
Location 2:126950099-126950121
Sequence CCACTGTGCTTGGCCGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937892595_937892599 5 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892599 2:126950127-126950149 TCCTATAATCCCAGCACTTTGGG 0: 624
1: 34661
2: 329784
3: 261939
4: 141126
937892595_937892598 4 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892598 2:126950126-126950148 CTCCTATAATCCCAGCACTTTGG 0: 487
1: 21995
2: 229355
3: 280664
4: 186066
937892595_937892606 18 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892606 2:126950140-126950162 GCACTTTGGGAGGCCGAGGTGGG 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
937892595_937892605 17 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892605 2:126950139-126950161 AGCACTTTGGGAGGCCGAGGTGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
937892595_937892607 21 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892607 2:126950143-126950165 CTTTGGGAGGCCGAGGTGGGCGG 0: 27130
1: 110883
2: 157143
3: 168159
4: 124493
937892595_937892603 14 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892603 2:126950136-126950158 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
937892595_937892601 8 Left 937892595 2:126950099-126950121 CCTGTCTCGGCCAAGCACAGTGG No data
Right 937892601 2:126950130-126950152 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937892595 Original CRISPR CCACTGTGCTTGGCCGAGAC AGG (reversed) Intergenic
No off target data available for this crispr