ID: 937904109

View in Genome Browser
Species Human (GRCh38)
Location 2:127043635-127043657
Sequence GCCCTAGGCCCGCTATAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937904103_937904109 -10 Left 937904103 2:127043622-127043644 CCGCCCTCCCGCTGCCCTAGGCC No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data
937904099_937904109 6 Left 937904099 2:127043606-127043628 CCTGCCCGGCTGCATTCCGCCCT No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data
937904097_937904109 27 Left 937904097 2:127043585-127043607 CCTGGAACACGAAGGAGCAAACC No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data
937904101_937904109 1 Left 937904101 2:127043611-127043633 CCGGCTGCATTCCGCCCTCCCGC No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data
937904096_937904109 28 Left 937904096 2:127043584-127043606 CCCTGGAACACGAAGGAGCAAAC No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data
937904095_937904109 29 Left 937904095 2:127043583-127043605 CCCCTGGAACACGAAGGAGCAAA No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data
937904100_937904109 2 Left 937904100 2:127043610-127043632 CCCGGCTGCATTCCGCCCTCCCG No data
Right 937904109 2:127043635-127043657 GCCCTAGGCCCGCTATAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937904109 Original CRISPR GCCCTAGGCCCGCTATAGGC TGG Intergenic
No off target data available for this crispr