ID: 937907103

View in Genome Browser
Species Human (GRCh38)
Location 2:127057786-127057808
Sequence GACCCCAGGCCACCCCCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 191}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937907100_937907103 -7 Left 937907100 2:127057770-127057792 CCAACATAGACACCAAGACCCCA 0: 1
1: 0
2: 0
3: 18
4: 197
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907096_937907103 -3 Left 937907096 2:127057766-127057788 CCCCCCAACATAGACACCAAGAC 0: 1
1: 0
2: 1
3: 7
4: 185
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907099_937907103 -6 Left 937907099 2:127057769-127057791 CCCAACATAGACACCAAGACCCC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907097_937907103 -4 Left 937907097 2:127057767-127057789 CCCCCAACATAGACACCAAGACC 0: 1
1: 0
2: 0
3: 12
4: 202
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907093_937907103 5 Left 937907093 2:127057758-127057780 CCTCCCAGCCCCCCAACATAGAC 0: 1
1: 0
2: 1
3: 42
4: 421
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907092_937907103 6 Left 937907092 2:127057757-127057779 CCCTCCCAGCCCCCCAACATAGA 0: 1
1: 0
2: 1
3: 20
4: 370
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907098_937907103 -5 Left 937907098 2:127057768-127057790 CCCCAACATAGACACCAAGACCC 0: 1
1: 0
2: 1
3: 17
4: 185
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907094_937907103 2 Left 937907094 2:127057761-127057783 CCCAGCCCCCCAACATAGACACC 0: 1
1: 0
2: 0
3: 21
4: 233
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191
937907095_937907103 1 Left 937907095 2:127057762-127057784 CCAGCCCCCCAACATAGACACCA 0: 1
1: 0
2: 0
3: 23
4: 320
Right 937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG 0: 1
1: 0
2: 0
3: 29
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937907103 Original CRISPR GACCCCAGGCCACCCCCGAG AGG Intronic
900119267 1:1041638-1041660 GACCCCGGGCGGCCCCCGATCGG - Exonic
900173921 1:1283804-1283826 GACCCCAGGCCTCCCCTGCAGGG + Intronic
900438727 1:2643122-2643144 GCCCCCAGGCCGCCCCAGTGGGG + Intronic
902292677 1:15445550-15445572 GCCACCAGGCCCCCCCCCAGAGG - Intronic
902687667 1:18089466-18089488 GACCCCAATGCACCCCCCAGGGG + Intergenic
904314210 1:29649900-29649922 GACCCCACGACGCCCCAGAGGGG - Intergenic
904399804 1:30248545-30248567 CACCCCAGGCCACCTGTGAGTGG + Intergenic
912454577 1:109789006-109789028 GAGCCCAGGCCACCACCTAGAGG - Intergenic
913675587 1:121137507-121137529 CACCCCACGCCACCCCCTACAGG - Intergenic
914027483 1:143925448-143925470 CACCCCACGCCACCCCCTACAGG - Intergenic
915316168 1:155030280-155030302 GACCCCAGGCCAGACCCCACAGG + Intronic
920380740 1:205533222-205533244 GACCCCAGACCCCCGCCCAGGGG - Intergenic
920380892 1:205534014-205534036 GACCCCAGGCTACCCCTGGGAGG - Intergenic
920462951 1:206156343-206156365 CACCCCACGCCACCCCCTACAGG - Intergenic
923880145 1:238095035-238095057 GCCCCCATGCCACCCCCAAGGGG - Intergenic
923880156 1:238095067-238095089 GCCCCCATGCCACCCTCAAGGGG - Intergenic
1065930269 10:30472912-30472934 GCCCCCAGGCCTCCACCCAGGGG - Intergenic
1067439624 10:46301302-46301324 GACCCCAGGCTTGCCCTGAGGGG + Intronic
1069962579 10:72087519-72087541 GACCCCAGCCCACCCCCGTACGG + Intronic
1073108092 10:101044282-101044304 GACCCCTGGCCACCTCCTAGGGG - Intergenic
1073207130 10:101775344-101775366 GGCCACAAGCCTCCCCCGAGGGG + Intronic
1073241947 10:102065152-102065174 GACCCCAGGACGCCGCCCAGTGG - Intergenic
1073473775 10:103739849-103739871 CACCCCAGCCCAGCCCAGAGTGG - Intronic
1074782384 10:116811371-116811393 GCCCCCAGGCCACCTCCGCAAGG + Intergenic
1076758395 10:132587316-132587338 GACCCCCTGCCACCCCTGTGAGG - Intronic
1077165016 11:1130964-1130986 GACCCCAGGCCCCCACCCAGAGG - Intergenic
1077171555 11:1168574-1168596 GACCCCAGGCAGCCCCGGGGTGG - Intronic
1077352511 11:2099494-2099516 GACCCCAGCCCACCCTCCTGAGG + Intergenic
1079004650 11:16783244-16783266 GACCCCAGGCCAGCATCCAGGGG + Intronic
1079076474 11:17388135-17388157 GGCCCTAGGCCACGTCCGAGGGG - Exonic
1079135761 11:17775291-17775313 CCCCCCAGGCCAGCCCCCAGTGG + Intronic
1081651489 11:44827066-44827088 GACTCCAGCCCAGCCCAGAGGGG - Intronic
1081767671 11:45622685-45622707 CATCCCAGGCCAGCCCCAAGGGG - Intergenic
1082160386 11:48883023-48883045 GACCCCAGGACACCCCCTCAAGG - Intergenic
1082161980 11:48897383-48897405 GACCCCAGGACACCCCCTCAAGG + Intergenic
1083314483 11:61805987-61806009 GAGCCCAGTCCAACCCCCAGAGG - Intronic
1084590337 11:70086495-70086517 CACCCCAGGGCACCCACCAGCGG + Intronic
1089359352 11:117875962-117875984 GACCCCAGGGCCCCCCGGAAAGG + Intronic
1090129392 11:124123783-124123805 CATCCCAGGCCACCCCCTACAGG + Exonic
1090732221 11:129581685-129581707 GCCCCCATGCCACCCCCGTAGGG - Intergenic
1094473243 12:30822661-30822683 GACCCCAGCCCAGCCCACAGAGG - Intergenic
1095446482 12:42287634-42287656 GTCACCATGCCACCCCAGAGGGG + Intronic
1101432108 12:104635171-104635193 GACCCCAGGTAACCCACGAGGGG + Intronic
1102230002 12:111256033-111256055 GACCCCAAAGCACCCCTGAGTGG + Intronic
1103590657 12:121989992-121990014 GACTCCAGCCCACCACCAAGAGG + Intronic
1103741949 12:123096968-123096990 GTCCCCAGGACTCCCCAGAGTGG + Intronic
1111556159 13:89884000-89884022 GTCCCGAGGCCAGCCCCGCGGGG + Intergenic
1114671047 14:24411276-24411298 GACCCTCTGCCACCCCAGAGTGG + Intronic
1117857546 14:60051280-60051302 GACTCCAGGCCCCCCACAAGGGG + Intronic
1119731928 14:76956624-76956646 TCCCCCAGGCCTCCCCCGAGCGG + Intergenic
1122123821 14:99568593-99568615 GACCCAGTGCCAACCCCGAGGGG + Intronic
1123023307 14:105412114-105412136 TACCCCAGGCCTCCTCCCAGCGG - Exonic
1123027445 14:105433419-105433441 GGCCTCAGGCCACCTCAGAGAGG - Intronic
1123117622 14:105901770-105901792 GATTCCAGGCCAGCCCCTAGCGG + Intergenic
1123630781 15:22258296-22258318 GCCCCCCGGCCTCCCCCGCGCGG + Intergenic
1124372257 15:29110505-29110527 GCCCCCAGGCCACCCCATGGTGG - Intronic
1125301001 15:38252995-38253017 GAACCCCGGCCACCCCCGCAGGG - Exonic
1128315519 15:66657039-66657061 CTCCCCAGGCCACTCCCCAGAGG - Intronic
1128374688 15:67066369-67066391 GACCCCGGGTCCCCCCCGGGCGG - Intronic
1128765834 15:70250669-70250691 GCCCGCAGGCCTCCCCCGAGAGG + Intergenic
1129706317 15:77796594-77796616 GGCCCCAGGCTGACCCCGAGAGG + Intronic
1129858518 15:78842111-78842133 GAAGCCAGGCCACCCCGGACAGG + Intronic
1130261098 15:82355110-82355132 GTGCCCCGGCCACCCCCGGGCGG + Intergenic
1130280137 15:82513908-82513930 GTGCCCCGGCCACCCCCGGGCGG - Intergenic
1130471512 15:84230094-84230116 GTGCCCCGGCCACCCCCGGGCGG - Intergenic
1130479006 15:84344665-84344687 GTGCCCCGGCCACCCCCGGGCGG - Intergenic
1130492764 15:84443466-84443488 GTGCCCCGGCCACCCCCGGGCGG + Intergenic
1130593806 15:85234721-85234743 GTGCCCCGGCCACCCCCGGGCGG - Intergenic
1131121988 15:89828503-89828525 GACCCCTGTCCAGCCCTGAGTGG - Intergenic
1131286571 15:91064071-91064093 CAGCCCAGACCTCCCCCGAGAGG + Intergenic
1132458694 16:38642-38664 GAGCCCAGGACACTCCCTAGGGG + Intergenic
1132678969 16:1131931-1131953 GACACAATGCCACCCCCGGGGGG + Intergenic
1132687639 16:1168920-1168942 GGCCCCAGCCCACCTCCTAGAGG - Intronic
1136983955 16:35082993-35083015 GTCCCCAGGCCACCCCTGCATGG + Intergenic
1139852646 16:69960303-69960325 GACCCCACGCTGCCCCCCAGAGG - Intronic
1139881617 16:70183211-70183233 GACCCCACGCTGCCCCCCAGAGG - Intronic
1140370891 16:74412294-74412316 GACCCCACGCTGCCCCCCAGAGG + Intronic
1141593387 16:85083084-85083106 GGCCCCAGGACACCCAAGAGTGG - Intronic
1141972263 16:87492277-87492299 GCCCCCCGGCCGCCCCCGCGCGG - Intergenic
1142027091 16:87820153-87820175 GACCCCAGGACCCCACCCAGGGG - Intergenic
1142299249 16:89247212-89247234 GACCAGGGGCCGCCCCCGAGCGG + Intergenic
1142810758 17:2394605-2394627 GACCCCAGCCCTCACCCAAGAGG + Intronic
1143126108 17:4641725-4641747 GACCCCAAGCGACCTCCGAGAGG - Intronic
1143370314 17:6435267-6435289 GACCACAGGCCCGGCCCGAGTGG - Intergenic
1143767075 17:9144900-9144922 GACCCCAGGACCCCCTGGAGAGG + Intronic
1144848970 17:18234493-18234515 GCCCCCAGACCACCCCCTCGGGG - Intronic
1145908491 17:28529164-28529186 CACCCCAGGCCAGCACCGATGGG + Exonic
1148625897 17:49068729-49068751 GAGCCCAGGCCATGCCCAAGGGG + Intergenic
1149544283 17:57491582-57491604 GACCCCAGGCCCTCCCAAAGAGG - Intronic
1149657484 17:58318041-58318063 CACCCCAGCCCACCCCTGGGAGG - Intronic
1150135434 17:62692668-62692690 GACCTCAGGCCCCCCCAGAAAGG - Exonic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151408058 17:73902275-73902297 GAACCCAGGCCACCACCGGGCGG - Intergenic
1151757248 17:76081983-76082005 GGCCCCAGCCCAGCCCCGAGAGG + Exonic
1152077700 17:78169155-78169177 GACCCGTGGCCTGCCCCGAGTGG - Intronic
1152093049 17:78257423-78257445 GAGCCCAGACAACCCCCCAGAGG - Intergenic
1152128386 17:78461115-78461137 GGCTCCGGGCCCCCCCCGAGAGG - Intronic
1152380042 17:79937571-79937593 GGCCCCAGCCCACCCCTGCGGGG - Exonic
1152716434 17:81902805-81902827 GACCCCAGGCCCCTCCGGCGCGG + Exonic
1152805809 17:82355536-82355558 CACCCCTGGCCACCACCGTGTGG + Intergenic
1154169211 18:12038635-12038657 GGCCCCAGGCCGCCCCCGGGCGG + Intergenic
1154314611 18:13294641-13294663 GAGCGCAGGCCACCCCAGATGGG - Intronic
1158783853 18:60685320-60685342 CACCCCAGGCCACTCCGGAGAGG + Intergenic
1159045785 18:63367370-63367392 GACACCCGGCGACCCCCGAGAGG - Exonic
1160038521 18:75322363-75322385 GACTCCAGGCCACTCCCACGGGG - Intergenic
1160539695 18:79613826-79613848 GACCCCAGGCCTCCCGCCTGTGG + Intergenic
1160712548 19:559180-559202 GATCCGAAGCCATCCCCGAGAGG + Intergenic
1160753969 19:748141-748163 ACGCCCAGGTCACCCCCGAGAGG - Exonic
1160773376 19:843736-843758 GACCCCAGGCCCCGCGCGCGTGG + Intronic
1161026562 19:2039896-2039918 GACCCCAGGGGTCCCCTGAGGGG - Intronic
1161911660 19:7198562-7198584 GACCCCAGGCCTCCCTCGGGAGG + Intronic
1163612007 19:18306565-18306587 GAGTCCAGGCCACCCAGGAGGGG + Exonic
1163727003 19:18928561-18928583 AACCCAAGGTCACCCCCCAGGGG + Exonic
1165308856 19:35018818-35018840 GACCCTGGGCCACCCCTGAGTGG + Intronic
1165922314 19:39307131-39307153 GACCCCAAGCCAGACCCGACCGG + Exonic
1166107354 19:40603932-40603954 GGCCCCAGGCCACCTCTGGGCGG - Intronic
1167267664 19:48491495-48491517 GCGTCCAGGCCCCCCCCGAGGGG - Exonic
1167324449 19:48815301-48815323 GACCCCAGGGCAAACCAGAGAGG - Intronic
925308367 2:2865574-2865596 GACCCCACACCACCCCAGACAGG - Intergenic
925308422 2:2865723-2865745 GACCCCACACCACCCCAGACAGG - Intergenic
925308478 2:2865877-2865899 GACCCCACACCACCCCAGACAGG - Intergenic
925308529 2:2866009-2866031 GACCCCACACCACCCCAGACAGG - Intergenic
925308613 2:2866243-2866265 GACCCCACCCCACCCCAGACAGG - Intergenic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
927787235 2:25982338-25982360 GACCCCCGGCCGCCCACGACCGG - Exonic
928127189 2:28625119-28625141 GCCCCCAGGCCACCCCTGAAAGG + Intronic
935408748 2:102736862-102736884 GAGCCCAGCCCCGCCCCGAGCGG + Intronic
937907103 2:127057786-127057808 GACCCCAGGCCACCCCCGAGAGG + Intronic
942190636 2:173465448-173465470 GACCCGAGGCCTCCCCCGACGGG + Intergenic
942459425 2:176159230-176159252 GACCCCAGCCCACCCCCACCCGG - Intronic
946226039 2:218264645-218264667 GACCCAAGCCCACCACCTAGGGG + Intronic
946488616 2:220126006-220126028 AACCCCAGTCAACCCCAGAGGGG + Intergenic
948201607 2:236133463-236133485 TACCTCTGGGCACCCCCGAGAGG + Intergenic
948206835 2:236167142-236167164 AACCCCAGGTCACCGCGGAGCGG + Intronic
948516036 2:238504560-238504582 ATCCCCAGGCCACCCCGGGGTGG - Intergenic
948517164 2:238511188-238511210 GGGCCCAGTCCTCCCCCGAGAGG - Intergenic
1170645033 20:18190265-18190287 TACCCCAGGCCACCTCCCAAGGG - Intergenic
1172061210 20:32188620-32188642 GACCACAGGCTACCACCAAGTGG - Intergenic
1173454495 20:43191421-43191443 ACTCCCAGGCCACCCCCGACAGG - Intergenic
1173822938 20:46030464-46030486 GGCCCCCCGCCGCCCCCGAGCGG + Intronic
1173846666 20:46192907-46192929 GTCCCCATGCCCCCCCCCAGTGG + Intronic
1175186172 20:57180808-57180830 GGCCCCAGGACACCCGCCAGGGG + Intronic
1175888884 20:62307361-62307383 GCCCCCAGCCCACCTGCGAGGGG - Exonic
1175993842 20:62803645-62803667 GGCCCCAGCCCAGCCCCTAGGGG - Intergenic
1176307261 21:5130315-5130337 GGCCTCACGCCACCCCCGGGAGG + Intergenic
1176375832 21:6086530-6086552 GCCCCCAGGCCACCCAGGAGTGG + Intergenic
1178581134 21:33839524-33839546 TCCCCCAGGCCACCCCCGTGTGG + Intronic
1179157384 21:38862426-38862448 GACACTAGGACACCCCCGACTGG + Intergenic
1179491579 21:41744764-41744786 GCCCCCAGGCCAGCCCCACGTGG - Intronic
1179747642 21:43451714-43451736 GCCCCCAGGCCACCCAGGAGTGG - Intergenic
1179849798 21:44131715-44131737 GGCCTCACGCCACCCCCGGGAGG - Intergenic
1179961043 21:44767107-44767129 GGCCCCAGGCCAACACCCAGAGG + Intergenic
1180089428 21:45526147-45526169 GCACCCAGGCCACCCTCGAGGGG + Intronic
1180206615 21:46264951-46264973 CACTCCAGGCCACACCCAAGGGG + Intronic
1181030100 22:20145489-20145511 GACCCGAGGCCACCCCAGCCTGG + Intronic
1181042090 22:20197042-20197064 GGCCCCAGGCCCCCCGCGAGGGG + Intergenic
1181513169 22:23397824-23397846 GACCCAAGGCCACCCCAGCCTGG - Intergenic
1181861008 22:25818160-25818182 GCCCCCAGCCCACTCCAGAGGGG - Intronic
1182061862 22:27404196-27404218 GACATGAGGCCACCCCTGAGAGG - Intergenic
1182088226 22:27576201-27576223 GTCCCCAAGACACCCTCGAGAGG + Intergenic
1183316086 22:37137586-37137608 GTCCCCAGGCCACACCTGGGAGG - Exonic
1184743415 22:46442376-46442398 CAACGCAGGCCATCCCCGAGGGG + Intronic
1185036102 22:48477688-48477710 GACCTCAGGCCAGCCCTGGGAGG + Intergenic
950433733 3:12966729-12966751 CACCCCAGTGCACCCCCAAGTGG + Intronic
952764956 3:36945478-36945500 GACCCCCAGCCTCCCCAGAGTGG - Intergenic
961359271 3:126357062-126357084 GACCCCTGCCCACCTCCGCGGGG + Intronic
961539721 3:127591153-127591175 GACCCCAGGTCACCCCTGCAGGG - Intronic
963891571 3:150641285-150641307 GCCCCCACCCCAACCCCGAGTGG - Intergenic
964480038 3:157130788-157130810 GACCCCATGCTACCCCCTTGTGG + Intergenic
965628273 3:170704426-170704448 GCCCCCACCCCACCCCCGACAGG + Intronic
966880371 3:184346582-184346604 CATCCTAGGCCACCCACGAGGGG + Exonic
968800916 4:2742837-2742859 GCCCACAGGCCACCACAGAGTGG + Intronic
968915482 4:3495420-3495442 GACTCCAGGCCACCGCTGTGGGG - Intronic
969251187 4:5969919-5969941 GACCCCAGGCCAGACCCTAGGGG + Intronic
969270136 4:6094076-6094098 CCCCCCAGGACTCCCCCGAGAGG + Intronic
969442860 4:7227599-7227621 CACCCCAGGCCACCACACAGAGG - Intronic
971153440 4:24058135-24058157 GCCCCCAGGCCACCCCTCTGGGG - Intergenic
978761525 4:112359175-112359197 TCCCCCAGGCCACCCCCCACAGG + Intronic
988557787 5:32253063-32253085 GCCCCCACCCCACCCACGAGGGG + Intronic
995253265 5:110018459-110018481 GACCCCATGCCACTCCCAAGTGG - Intergenic
996978223 5:129460183-129460205 GACCCCACCCCACCCCCGCCAGG + Intergenic
998505382 5:142668032-142668054 GAGCCCAGGCCCTCCCCCAGGGG - Intronic
1001246853 5:170111341-170111363 GAGCCCAAGCCAACCCAGAGGGG + Intergenic
1002574060 5:180161617-180161639 GACGCCAGGCCGAGCCCGAGAGG + Intronic
1013374760 6:109503823-109503845 GACCGCAGGCCACCCCGGGAGGG - Intronic
1015158553 6:130125724-130125746 AACCCCAGGCCACCCCAGCCAGG - Intronic
1017233947 6:152100142-152100164 GATCCCAGGGCACCCCCAAAGGG - Exonic
1017721374 6:157245682-157245704 GCTCCCAGGCCACTCCTGAGAGG + Intergenic
1018833342 6:167463174-167463196 GAGGCCAGGCCACCCACAAGGGG - Intergenic
1019484917 7:1284993-1285015 AACCTCAGGCCACCCCAGAAGGG - Intergenic
1019558656 7:1645168-1645190 CACCCCAGGACACCCCTGGGTGG + Intergenic
1019710738 7:2517111-2517133 GACCCCAGGTCTCCCTCTAGGGG - Intronic
1021862547 7:24921484-24921506 GTGCCCAGGCCAGCCCAGAGAGG + Intronic
1026634551 7:72069932-72069954 GACCTCAGGACATCCCCAAGAGG - Intronic
1032196849 7:129794388-129794410 GCTCCCAGGCCACCCCAGACTGG + Intergenic
1032434243 7:131887262-131887284 GACCACTGCCCACCCCCCAGAGG - Intergenic
1033290633 7:140079735-140079757 GACCACAGGCAGCCCCAGAGTGG - Intergenic
1034265076 7:149776857-149776879 GTCCCCAGGCCTCCCCAGGGTGG + Intergenic
1034900868 7:154907142-154907164 GTCCCCAGCCCTGCCCCGAGGGG - Intergenic
1036225278 8:6952808-6952830 ACTCCCAGGCCACCCCAGAGGGG - Intergenic
1036396770 8:8377193-8377215 GCCCCCGGCCCACCCCCGGGAGG - Exonic
1038600960 8:28942009-28942031 GCCCTCAGGCCACCCCAGTGTGG + Intronic
1038931380 8:32197367-32197389 GAGCCAAGGCCACCTCCCAGAGG - Intronic
1041051565 8:53939644-53939666 CGCCCCAGGCCAGCCCGGAGCGG + Exonic
1045221454 8:100204270-100204292 GACCTCTGGCCAGCCCCTAGAGG + Intronic
1048205478 8:132412055-132412077 CACCCCATGGCACCCCAGAGAGG + Intronic
1048484109 8:134831853-134831875 GACCCCACGACGCCCCCCAGAGG + Intergenic
1049256304 8:141615739-141615761 GACCCTAGGGCACCCCTGAGTGG + Intergenic
1049462050 8:142734815-142734837 GGCTCCAGGCCACTCCTGAGGGG - Intronic
1049569184 8:143360436-143360458 GCCGCCAGGCCACACCCGTGGGG + Intergenic
1051371967 9:16366402-16366424 GACACCAGGCAAGCCCAGAGAGG - Intergenic
1053293264 9:36896053-36896075 AACCCCAGGCCACCCACCAGAGG + Intronic
1056977571 9:91273149-91273171 AGCCCCAAGCCACACCCGAGAGG + Intronic
1059415025 9:114156922-114156944 GACACCAGGACACTCCCCAGAGG + Intronic
1059755451 9:117289237-117289259 GACCCAAGGCTACCACCGTGTGG - Intronic
1060729757 9:126029916-126029938 GACACCAGGCCTCCCCTCAGAGG - Intergenic
1061208253 9:129176719-129176741 GCCCCCAGCTCAGCCCCGAGTGG + Exonic
1062265213 9:135683760-135683782 CACCCCAGGCCAGCCCTGAGGGG + Intergenic
1062352659 9:136146902-136146924 AGGCCCAGGCCACCCCCGTGTGG + Intergenic
1189346822 X:40248160-40248182 GACTGCAGGCCACCCCCATGAGG - Intergenic
1195122141 X:101765568-101765590 GACCCCAATCAACCCCCGACAGG - Intergenic