ID: 937912176

View in Genome Browser
Species Human (GRCh38)
Location 2:127081061-127081083
Sequence CTCCCTGTACCCACAGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912176_937912181 7 Left 937912176 2:127081061-127081083 CCGCTCCCTGTGGGTACAGGGAG No data
Right 937912181 2:127081091-127081113 ACCCTCCAACAGCCCCCGCATGG No data
937912176_937912186 16 Left 937912176 2:127081061-127081083 CCGCTCCCTGTGGGTACAGGGAG No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912176_937912184 11 Left 937912176 2:127081061-127081083 CCGCTCCCTGTGGGTACAGGGAG No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912176 Original CRISPR CTCCCTGTACCCACAGGGAG CGG (reversed) Intronic