ID: 937912177

View in Genome Browser
Species Human (GRCh38)
Location 2:127081066-127081088
Sequence CAGGACTCCCTGTACCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912177_937912186 11 Left 937912177 2:127081066-127081088 CCCTGTGGGTACAGGGAGTCCTG No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912177_937912181 2 Left 937912177 2:127081066-127081088 CCCTGTGGGTACAGGGAGTCCTG No data
Right 937912181 2:127081091-127081113 ACCCTCCAACAGCCCCCGCATGG No data
937912177_937912184 6 Left 937912177 2:127081066-127081088 CCCTGTGGGTACAGGGAGTCCTG No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912177 Original CRISPR CAGGACTCCCTGTACCCACA GGG (reversed) Intronic
No off target data available for this crispr