ID: 937912178

View in Genome Browser
Species Human (GRCh38)
Location 2:127081067-127081089
Sequence GCAGGACTCCCTGTACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912178_937912184 5 Left 937912178 2:127081067-127081089 CCTGTGGGTACAGGGAGTCCTGC No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data
937912178_937912181 1 Left 937912178 2:127081067-127081089 CCTGTGGGTACAGGGAGTCCTGC No data
Right 937912181 2:127081091-127081113 ACCCTCCAACAGCCCCCGCATGG No data
937912178_937912186 10 Left 937912178 2:127081067-127081089 CCTGTGGGTACAGGGAGTCCTGC No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912178 Original CRISPR GCAGGACTCCCTGTACCCAC AGG (reversed) Intronic