ID: 937912179

View in Genome Browser
Species Human (GRCh38)
Location 2:127081085-127081107
Sequence GGGGGCTGTTGGAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912179_937912195 19 Left 937912179 2:127081085-127081107 CCTGCCACCCTCCAACAGCCCCC No data
Right 937912195 2:127081127-127081149 GACCCACAGCGTGAGTCATGGGG No data
937912179_937912186 -8 Left 937912179 2:127081085-127081107 CCTGCCACCCTCCAACAGCCCCC No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912179_937912194 18 Left 937912179 2:127081085-127081107 CCTGCCACCCTCCAACAGCCCCC No data
Right 937912194 2:127081126-127081148 TGACCCACAGCGTGAGTCATGGG No data
937912179_937912193 17 Left 937912179 2:127081085-127081107 CCTGCCACCCTCCAACAGCCCCC No data
Right 937912193 2:127081125-127081147 CTGACCCACAGCGTGAGTCATGG No data
937912179_937912198 25 Left 937912179 2:127081085-127081107 CCTGCCACCCTCCAACAGCCCCC No data
Right 937912198 2:127081133-127081155 CAGCGTGAGTCATGGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912179 Original CRISPR GGGGGCTGTTGGAGGGTGGC AGG (reversed) Intronic