ID: 937912184

View in Genome Browser
Species Human (GRCh38)
Location 2:127081095-127081117
Sequence TCCAACAGCCCCCGCATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912170_937912184 23 Left 937912170 2:127081049-127081071 CCCTGGCGTCAGCCGCTCCCTGT No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data
937912178_937912184 5 Left 937912178 2:127081067-127081089 CCTGTGGGTACAGGGAGTCCTGC No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data
937912176_937912184 11 Left 937912176 2:127081061-127081083 CCGCTCCCTGTGGGTACAGGGAG No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data
937912171_937912184 22 Left 937912171 2:127081050-127081072 CCTGGCGTCAGCCGCTCCCTGTG No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data
937912177_937912184 6 Left 937912177 2:127081066-127081088 CCCTGTGGGTACAGGGAGTCCTG No data
Right 937912184 2:127081095-127081117 TCCAACAGCCCCCGCATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912184 Original CRISPR TCCAACAGCCCCCGCATGGC AGG Intronic