ID: 937912186

View in Genome Browser
Species Human (GRCh38)
Location 2:127081100-127081122
Sequence CAGCCCCCGCATGGCAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912176_937912186 16 Left 937912176 2:127081061-127081083 CCGCTCCCTGTGGGTACAGGGAG No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912177_937912186 11 Left 937912177 2:127081066-127081088 CCCTGTGGGTACAGGGAGTCCTG No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912170_937912186 28 Left 937912170 2:127081049-127081071 CCCTGGCGTCAGCCGCTCCCTGT No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912179_937912186 -8 Left 937912179 2:127081085-127081107 CCTGCCACCCTCCAACAGCCCCC No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912171_937912186 27 Left 937912171 2:127081050-127081072 CCTGGCGTCAGCCGCTCCCTGTG No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data
937912178_937912186 10 Left 937912178 2:127081067-127081089 CCTGTGGGTACAGGGAGTCCTGC No data
Right 937912186 2:127081100-127081122 CAGCCCCCGCATGGCAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912186 Original CRISPR CAGCCCCCGCATGGCAGGCA AGG Intronic