ID: 937912787

View in Genome Browser
Species Human (GRCh38)
Location 2:127083939-127083961
Sequence CAAACACGACTCAGACCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937912787_937912790 -5 Left 937912787 2:127083939-127083961 CCGCCGGGTCTGAGTCGTGTTTG No data
Right 937912790 2:127083957-127083979 GTTTGCCAGATCTCTTGGAAAGG No data
937912787_937912793 25 Left 937912787 2:127083939-127083961 CCGCCGGGTCTGAGTCGTGTTTG No data
Right 937912793 2:127083987-127084009 CTTTTCTCTTAGTCATCTGCAGG No data
937912787_937912789 -10 Left 937912787 2:127083939-127083961 CCGCCGGGTCTGAGTCGTGTTTG No data
Right 937912789 2:127083952-127083974 GTCGTGTTTGCCAGATCTCTTGG No data
937912787_937912791 -1 Left 937912787 2:127083939-127083961 CCGCCGGGTCTGAGTCGTGTTTG No data
Right 937912791 2:127083961-127083983 GCCAGATCTCTTGGAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937912787 Original CRISPR CAAACACGACTCAGACCCGG CGG (reversed) Intronic
No off target data available for this crispr