ID: 937914579

View in Genome Browser
Species Human (GRCh38)
Location 2:127092629-127092651
Sequence GGTGACTTGCCCGGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937914579_937914584 -10 Left 937914579 2:127092629-127092651 CCCGCAGCCCCGGGCAAGTCACC No data
Right 937914584 2:127092642-127092664 GCAAGTCACCAGCCTTCCAGAGG No data
937914579_937914591 25 Left 937914579 2:127092629-127092651 CCCGCAGCCCCGGGCAAGTCACC No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937914579 Original CRISPR GGTGACTTGCCCGGGGCTGC GGG (reversed) Intronic