ID: 937914584

View in Genome Browser
Species Human (GRCh38)
Location 2:127092642-127092664
Sequence GCAAGTCACCAGCCTTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937914577_937914584 -2 Left 937914577 2:127092621-127092643 CCCACTGACCCGCAGCCCCGGGC No data
Right 937914584 2:127092642-127092664 GCAAGTCACCAGCCTTCCAGAGG No data
937914574_937914584 1 Left 937914574 2:127092618-127092640 CCTCCCACTGACCCGCAGCCCCG No data
Right 937914584 2:127092642-127092664 GCAAGTCACCAGCCTTCCAGAGG No data
937914579_937914584 -10 Left 937914579 2:127092629-127092651 CCCGCAGCCCCGGGCAAGTCACC No data
Right 937914584 2:127092642-127092664 GCAAGTCACCAGCCTTCCAGAGG No data
937914578_937914584 -3 Left 937914578 2:127092622-127092644 CCACTGACCCGCAGCCCCGGGCA No data
Right 937914584 2:127092642-127092664 GCAAGTCACCAGCCTTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937914584 Original CRISPR GCAAGTCACCAGCCTTCCAG AGG Intronic