ID: 937914591

View in Genome Browser
Species Human (GRCh38)
Location 2:127092677-127092699
Sequence GTCCCAGTCATCATCTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937914586_937914591 0 Left 937914586 2:127092654-127092676 CCTTCCAGAGGATCCACCCTGCA No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914587_937914591 -4 Left 937914587 2:127092658-127092680 CCAGAGGATCCACCCTGCAGTCC No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914585_937914591 4 Left 937914585 2:127092650-127092672 CCAGCCTTCCAGAGGATCCACCC No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914580_937914591 24 Left 937914580 2:127092630-127092652 CCGCAGCCCCGGGCAAGTCACCA No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914579_937914591 25 Left 937914579 2:127092629-127092651 CCCGCAGCCCCGGGCAAGTCACC No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914583_937914591 16 Left 937914583 2:127092638-127092660 CCGGGCAAGTCACCAGCCTTCCA No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914582_937914591 17 Left 937914582 2:127092637-127092659 CCCGGGCAAGTCACCAGCCTTCC No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data
937914581_937914591 18 Left 937914581 2:127092636-127092658 CCCCGGGCAAGTCACCAGCCTTC No data
Right 937914591 2:127092677-127092699 GTCCCAGTCATCATCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937914591 Original CRISPR GTCCCAGTCATCATCTAGAA AGG Intronic