ID: 937915168

View in Genome Browser
Species Human (GRCh38)
Location 2:127095381-127095403
Sequence GATCCACCAGTGACCCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937915168_937915179 19 Left 937915168 2:127095381-127095403 CCTGGCGGGGTCACTGGTGGATC No data
Right 937915179 2:127095423-127095445 AGGTGAAGGGCCTGGCTCTGTGG No data
937915168_937915176 11 Left 937915168 2:127095381-127095403 CCTGGCGGGGTCACTGGTGGATC No data
Right 937915176 2:127095415-127095437 AAATCCCAAGGTGAAGGGCCTGG No data
937915168_937915180 20 Left 937915168 2:127095381-127095403 CCTGGCGGGGTCACTGGTGGATC No data
Right 937915180 2:127095424-127095446 GGTGAAGGGCCTGGCTCTGTGGG No data
937915168_937915174 5 Left 937915168 2:127095381-127095403 CCTGGCGGGGTCACTGGTGGATC No data
Right 937915174 2:127095409-127095431 GTATGGAAATCCCAAGGTGAAGG No data
937915168_937915172 -1 Left 937915168 2:127095381-127095403 CCTGGCGGGGTCACTGGTGGATC No data
Right 937915172 2:127095403-127095425 CCCGGAGTATGGAAATCCCAAGG No data
937915168_937915175 6 Left 937915168 2:127095381-127095403 CCTGGCGGGGTCACTGGTGGATC No data
Right 937915175 2:127095410-127095432 TATGGAAATCCCAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937915168 Original CRISPR GATCCACCAGTGACCCCGCC AGG (reversed) Intronic
No off target data available for this crispr