ID: 937921294

View in Genome Browser
Species Human (GRCh38)
Location 2:127133462-127133484
Sequence CTCTTTCTGATGGGACTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937921294_937921305 21 Left 937921294 2:127133462-127133484 CCCCACAGTCCCATCAGAAAGAG No data
Right 937921305 2:127133506-127133528 AGACTGCAGAGAGAAAAGTGAGG No data
937921294_937921303 -3 Left 937921294 2:127133462-127133484 CCCCACAGTCCCATCAGAAAGAG No data
Right 937921303 2:127133482-127133504 GAGGAGGGCAGGAGAACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937921294 Original CRISPR CTCTTTCTGATGGGACTGTG GGG (reversed) Intergenic
No off target data available for this crispr