ID: 937922720

View in Genome Browser
Species Human (GRCh38)
Location 2:127143228-127143250
Sequence CCTTTGGAGGAGCAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937922720_937922727 10 Left 937922720 2:127143228-127143250 CCATCCTTCTGCTCCTCCAAAGG No data
Right 937922727 2:127143261-127143283 TCTGCAGAGCACATGTAGACTGG No data
937922720_937922728 22 Left 937922720 2:127143228-127143250 CCATCCTTCTGCTCCTCCAAAGG No data
Right 937922728 2:127143273-127143295 ATGTAGACTGGTGAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937922720 Original CRISPR CCTTTGGAGGAGCAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr