ID: 937922875

View in Genome Browser
Species Human (GRCh38)
Location 2:127144338-127144360
Sequence CTCTGCATCAGGAGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937922875_937922885 26 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922885 2:127144387-127144409 GACCAACGCCTTCTTCTTCAAGG No data
937922875_937922881 -5 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922881 2:127144356-127144378 CAGAGGAAACTTTCAAGGCTGGG No data
937922875_937922880 -6 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922880 2:127144355-127144377 GCAGAGGAAACTTTCAAGGCTGG No data
937922875_937922884 4 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922884 2:127144365-127144387 CTTTCAAGGCTGGGGCTTCAGGG No data
937922875_937922882 -4 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922882 2:127144357-127144379 AGAGGAAACTTTCAAGGCTGGGG No data
937922875_937922879 -10 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922879 2:127144351-127144373 TGATGCAGAGGAAACTTTCAAGG No data
937922875_937922883 3 Left 937922875 2:127144338-127144360 CCTTCCTGGCTCCTGATGCAGAG No data
Right 937922883 2:127144364-127144386 ACTTTCAAGGCTGGGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937922875 Original CRISPR CTCTGCATCAGGAGCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr