ID: 937925850

View in Genome Browser
Species Human (GRCh38)
Location 2:127166753-127166775
Sequence CAGGCAGAAGCAGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937925848_937925850 -7 Left 937925848 2:127166737-127166759 CCTGGAGAGGCTGTATCAGGCAG No data
Right 937925850 2:127166753-127166775 CAGGCAGAAGCAGCTTTTCTGGG No data
937925842_937925850 26 Left 937925842 2:127166704-127166726 CCACTGACAGCAAGAGGCTCTCA No data
Right 937925850 2:127166753-127166775 CAGGCAGAAGCAGCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937925850 Original CRISPR CAGGCAGAAGCAGCTTTTCT GGG Intergenic
No off target data available for this crispr